Oncotarget

Advance Publications: Research Papers:

This article has been retracted. Retraction in: https://doi.org/10.18632/oncotarget.14017

Triptolide contributes to decrease in TLR4 expression by upregulating miR-224-3p to inhibit the inflammatory reaction in diabetic nephropathy

PDF |  HTML  |  How to cite

DOI pending

Metrics: PDF 973 views  |   HTML 1097 views  |   ?  

Bei Sun, Shaolan Hu, Yongmei Li, Endong Zhu, Li Li, Fei Han, Chun-Jun Li and Liming Chen _

Abstract

Bei Sun1,*, Shaolan Hu1,*, Yongmei Li2, Endong Zhu1, Li Li1, Fei Han1, Chun-Jun Li1 and Liming Chen1

1 Key Laboratory of Hormones and Development, Ministry of Health, Tianjin Key Laboratory of Metabolic Diseases, Tianjin Metabolic Diseases Hospital & Tianjin Institute of Endocrinology, Tianjin Medical University, Tianjin, China

2 Department of Medical Microbiology, School of Basic Medical Sciences, Tianjin Medical University, Tianjin, China

* These authors have contributed equally to this work

Correspondence to:

Liming Chen, email:

Chun-Jun Li, email:

Keywords: diabetic nephropathy, triptolide, miRNA, TLR4, inflammation, Pathology Section

Received: August 01, 2016 Accepted: October 13, 2016 Published: November 04, 2016

Abstract

Triptolide has been shown to have anti-inflammatory properties. miRNAs have emerged as important regulators of DN. However, the role of miRNAs in inflammation regulation during DN development is poorly understood. In this study, we investigated the effects of the association between miRNAs and triptolide on inflammation in DN. We found that triptolide significantly inhibits the inflammatory reactions of DN in rats, and miR-224-3p is selectively upregulated more than 2 fold in NRK-52E cells treated with triptolide compared to the cells without treatment. miR-224-3p overexpression exerts similar effects to those of triptolide, while miR-224-3p downregulation increases all the inflammatory reactions above. In summary, we found that triptolide attenuates the inflammatory reactions in DN by upregulating miR-224-3p expression.


INTRODUCTION

Diabetic nephropathy (DN) has become an important cause of end-stage renal disease and death in diabetic patients [1, 2] . Approximate 40% of patients with type 2 diabetes (T2D) will develop DN and even renal failure [3]. However, the pathogenesis of DN is complex, and inflammation theory and immune system activation have attracted the interest of scientists worldwide [4] .

TLRs represent the receptors of the innate immune system [5]. TLRs activate downstream inflammatory response, such as the NF-κB pathway, which initiates the acquired immune response [6]. TLR4 activation promotes tubulointerstitial inflammation and fibrosis, which deteriorated the renal function of DN [7].

Unfortunately, there are no effective treatments for DN [8-10]. In recent years, treatment of DN with traditional Chinese medicines has achieved positive results [11, 12]. Tripterygium glycosides can promote the production of anti-inflammatory mediators in many cells. Triptolide is the most active ingredient of tripterygium glycosides [13-15]. Our previous study showed that triptolide could ameliorate tubulointerstitial fibrosis via TLR4/NF-κB [16].

miRNAs bind specific genes and facilitate mRNA cleavage or mRNA translation inhibition and thus participate in a variety of physiological and pathological processes [17]. Recent studies have shown that miRNAs correlate with DN [18-20].

We studied the mechanism underlying the anti-inflammatory effects of triptolide via biochip technology in DN rats. Triptolide attenuated inflammation by upregulating miR-224-3p expression and the plasma levels of miR-224-3p were significantly lower in the patients with DN.

RESULTS

Effects of triptolide treatment on blood biochemical parameters

The blood biochemical parameters were showed in Table 1. During the study period, the levels of blood glucose, TC and TG were significantly higher in both DN and TP-treated rats compared with the NC rats (P < 0.05). However, there were no significant differences between DN and TP-treated groups (P > 0.05), indicating that TP had no effects on blood glucose and blood lipid. In addition, the AST and ALT levels did not differ among the five groups (P > 0.05). Furthermore, Scr and BUN did not change in these groups by the end of the experiment (P > 0.05).

Table 1: Physical and biochemical parameters of the rats in different groups (mean ± SD)

NC (n = 15)

DN (n = 15)

DN+TP (n = 15)

Blood glucose (mmol/L)

6.0 ± 0.2

28.2 ± 3.0a

29.0 ± 3.1a

TC (mmol/L)

3.7 ± 1.2

6.5 ± 1.9*

6.2 ± 2.0*

TG (mmol/L)

1.5 ± 1.2

4.1 ± 1.8*

3.8 ± 1.4*

ALT (mmol/L)

49.7 ± 7.5

55.1 ± 5.1

54.2 ± 8.9

AST (mmol/L)

75.1 ± 7.1

79.4 ± 6.4

82.2 ± 6.3

BUN (mmol/L)

6.9 ± 2.0

6.7 ± 1.6

6.8 ± 1.2

Scr (mmol/L)

62.8 ± 8.4

61.3 ± 7.3

61.5 ± 7.8

24-h urine protein (mg/24 h)

45.7 ± 14.5

253.7 ± 33.0*

119.0 ± 22.0*#

NAG

12.3 ± 4.1

59.5 ± 9.3*

29.4 ± 7.2*#

KW/BW

3.21 ± 0.18

6.78 ± 0.48a*

4.55 ± 0.38*#

TC: total cholesterol; TG: total triglycerides; ALT: alanine transaminase; AST: aspartate transaminase; BUN: blood urea nitrogen; Scr: serum creatinine; NC: normal control; DN: diabetic nephropathy rats without drug treatment; DN+TP: diabetic nephropathy rats treated with triptolide ( triptolide 200 μg/kg∙d via gavage for 12 weeks) .*p < 0.05 versus NC group, #p < 0.05 versus DN group.

Effect of triptolide on urinary protein, NAG and KW/BW

The 24 h urine protein was significantly increased in the DN rats compared with that in the NC rats (P < 0.05), which was attenuated after TP administration for 8 weeks (P < 0.05). NAG, one of the urinary tubular injury biomarkers, was significantly increased in the DN rats compared with that in the NC rats, but was markedly reduced by TP treatment (P < 0.05). The kidney weight to body weight ratio (KW/BW) was significantly higher in the DN rats compared with the KW/BW in the NC rats (P < 0.05). By contrast, KW/BW was significantly reduced in the TP treatment group (P < 0.05), but still remained significantly higher in comparison with normal control (Table 1).

Triptolide attenuated renal histopathological changes in DN rats

The renal tubules in DN rats exhibited signs of atrophy and luminal dilatation, as well as evidence of inflammatory cell infiltration in HE staining, compared to those in the NC rats. In the triptolide group, the degree of inflammatory cell infiltration was significantly reduced (Figure 1A). Masson staining results indicated that triptolide attenuates renal tubulointerstitial fibrosis (Figure 1B).

Pathological analysis of rat kidney tissue.

Figure 1: Pathological analysis of rat kidney tissue. A. HE staining. B. Representative Masson’s staining. C. Semiquantitative tubulointerstitial fibrosis scoress. NC, normal control; DN without drug treatment; TP, triptolide treatment (200 μg/kg∙d). * p < 0.05 versus NC group, # p < 0.05 versus DN group.

Triptolide improved renal inflammation in DN rats

The expression levels of TLR4, NF-κB, TGF-β1 and ICAM-1 were significantly increased in the DN group, compared with those in the NC group. After treated with triptolide, the situation was significantly improved (Figure 2A-2G).

Triptolide improves renal inflammation in DN rats.

Figure 2: Triptolide improves renal inflammation in DN rats. A. Immunostaining B. The mRNA expression levels C. Representative western blotting. D.-G. Densitometric results for TLR4, NF-κB, TGF-β1 and ICAM-1, as determined via western blotting. NC, normal control; DN without drug treatment; TP, triptolide treatment (200 μg/kg∙d). * p < 0.05 versus NC group, # p < 0.05 versus DN group.

Triptolide attenuated high glucose-induced inflammation in NRK-52E cells

The mRNA and protein expression levels of TLR4, NF-κB, TGF-β1 and ICAM-1 were significantly higher in NRK-52E cells stimulated with high glucose concentrations for 48 h than those in NC cells. Following 48h triptolide, cytokines above were significantly decreased (Figure 3).

Triptolide reduces the inflammatory responses induced by high glucose concentrations in NRK-52E cells.

Figure 3: Triptolide reduces the inflammatory responses induced by high glucose concentrations in NRK-52E cells. A. The mRNA expression levels B. Representative western blotting. C.-F. Densitometric results determined via western blotting. NG, NRK-52E cells treated with normal glucose (5.56 mmol/L); MA, NRK-52E cells treated with normal glucose (5.56 mmol/L) + mannitol (54.44 mmol/L); HG, NRK-52E cells treated with high glucose (30 mmol/L); HG+TP, NRK-52E cells treated with high glucose + 5 ng/mL triptolide. * p < 0.05 versus NG group, # p < 0.05 versus HG group.

Effects of Triptolide on expression of miR-224-3p

miRNA microarray analysis showed that miR-224-3p expression was significantly decreased in the HG group, while returned to normal level in the HG+TP group (Figure 4A, 4B). We subsequently increased our sample size and utilized qPCR to verify the differences in miR-224-3p expression in each group. Our results were consistent with the miRNA microarray analysis data (Figure 4C).

miRNA microarray analysis showed that the expression level of miR-224-3p was significantly different among the three groups.

Figure 4: miRNA microarray analysis showed that the expression level of miR-224-3p was significantly different among the three groups. A. Hierarchical clustering of the normal and model groups. Differential miRNA expression profiles were observed. Red indicates upregulated miRNAs (higher expression), and green indicates downregulated miRNAs (lower expression); the aggregation tree is above the sample, and the miRNA aggregation tree is on the right. B. Statistical analysis: differential expression of miR-224-3p in each group, according to the aggregation tree. C. Differential expression of miR-224-3p in each group. The level of miR-224-3p expression is expressed relative to that of U6 snRNA. NG, NRK-52E cells treated with normal glucose (5.56 mmol/L); HG, NRK-52E cells treated with high glucose (30 mmol/L); HG+TP, NRK-52E cells treated with high glucose + 5 ng/mL triptolide. * p < 0.05 versus NG group, # p < 0.05 versus HG group.

miR-224-3p overexpression reduced the levels of TLR4, NF-κB, TGF-β1 and ICAM-1 expression

We ectopically expressed miR-224-3p in NRK-52E cells using miR-224-3p mimics (miR-224-3pm). After overexpression of miR-224-3pm, the levels of TLR4, NF-κB, TGF-β1 and ICAM-1 expressions were significantly decreased compared to those of NC (Figure 5A-5F).

miR-224-3p overexpression reduces TLR4, NF-&#x3ba;B, TGF-&#x3b2;1 and ICAM-1expression in NRK-52E cells transfected with an miR224-3p mimic.

Figure 5: miR-224-3p overexpression reduces TLR4, NF-κB, TGF-β1 and ICAM-1expression in NRK-52E cells transfected with an miR224-3p mimic. A. The mRNA expression B. Representative western blotting (C.-F. Densitometric results determined via western blotting. NG, NRK-52E cells treated with normal glucose (5.56 mmol/L); HG, NRK-52E cells treated with high glucose (30 mmol/L); HG+miR-NC, NRK-52E cells transfected with miR224-3p mimic control; HG+miR-3pm, NRK-52E cells transfected with miR224-3p mimic. * p < 0.05 versus NG group, # p < 0.05 versus HG group.

miR-224-3p downregulation reversed the anti-inflammatory effects of triptolide

To determine the effects of miR-224-3p on the anti-inflammatory effects of triptolide, we transfected miR-224-3p inhibitors (miR-224-3pi) into NRK-52E cells. In contrast, following triptolide treatment, the expression levels of TLR4, NF-κB, TGF-β1 and ICAM-1 were significantly increased (Figure 6), indicating that miR-224-3p reversed the anti-inflammatory effects of triptolide.

Downregulation of miR-224-3p expression reversed the anti-inflammatory effects of triptolide.

Figure 6: Downregulation of miR-224-3p expression reversed the anti-inflammatory effects of triptolide. NRK-52E cells were treated with triptolide alone or triptolide after transfection with an NC inhibitor and a miR-224 inhibitor. A. The mRNA expression levels B. Representative western blotting. (C-F) Densitometric results for TLR4, NF-κB, TGF-β1 and ICAM-1, as determined via western blotting. NG, NRK-52E cells treated with normal glucose (5.56 mmol/L); HG, NRK-52E cells treated with high glucose (30 mmol/L); HG+TP,NRK-52E cells treated with high glucose + 5 ng/mL triptolide; HG+TP+miR-iNC, NRK-52E cells transfected with miR224-3p inhibitor control + 5 ng/mL triptolide; HG+TP+miR-3pi, NRK-52E cells transfected miR224-3p inhibitor + 5 ng/mL triptolide. * p < 0.05 versus NG group, # p < 0.05 versus HG group, □ p < 0.05 versus HG+TP group.

miR-224-3p binding and suppression of TLR-4 expression in NRK-52E cells

To elucidate the molecular mechanisms underlying the anti-inflammatory effects of miR-224-3p, we next attempted to identify potential inflammatory pathway targets. TargetScan analysis predicted one putative miR-224-3p binding site within the 3’UTR of TLR4 (Figure 7A). To determine if miR-224-3p effectively inhibits TLR-4 expression through its interaction with the TLR4 3’UTR, we utilized a dual-luciferase reporter system. These results confirmed that TLR4 is a direct target of miR-224-3p and miR-224-3p can reduce the expression of TLR-4 in NRK-52E cells (Figure 7B).

Target gene prediction and identification of miR-224-3p.

Figure 7: Target gene prediction and identification of miR-224-3p. A. Alignment of miR-224-3p with the predicted target region in the TLR4 3’UTR. A seven-nucleotide interaction sequence among the wild-type (wt) TLR4 3’UTR, miR-142-3p and the mutant TLR4 3’UTR construct is shown. B. Luciferase reporter assay using HEK-293 cells to show the direct interactions between miR-224-3p and the 3’UTR of TLR4. After 24 hours, the miR-224-3p mimic (10 nmol/L) reduced the ratio of Renilla-to-Firefly expression, but not when the 3’UTR bore 2 point mutations at the miR-224-3p binding site. C. TLR4 protein expression levels in NRK-52E cells transfected with the miR224-3p mimic were examined via western blotting. (D) Densitometric results for TLR4, as determined via western blotting.

The plasma miR-224-3p level was significantly decreased in DN patients

Interestingly, we also detected the plasma levels of miR-224-3p via qPCR in three groups (NC, DM, and DN). The plasma level of miR-224-3p expression in the DM patients was similar to that of NC. However, the level of miR-224-3p in the DN patients was significantly lower.

DISCUSSION

DN is a type of glomerular disease mainly characterized by vascular damage. In recent years, renal tubular lesions and interstitial fibrosis have been found to be unique in terms of pathogenesis [21] . We found that renal tubules of DN rats exhibited pathological changes, such as partial epithelial cell brush border detachment, as well as vacuolization and granular degeneration. Inflammatory cell infiltration was also noted.

More and more researchers have concluded that DN is a type of autoimmune disease [22]. Renal cells in the settings of hyperglycemia and hemodynamic alterations can produce many types of inflammatory cytokines, which trigger an inflammatory cascade reaction [23], resulting in the development of DN.

TLRs are important factors in inflammatory reactions, served as a bridge linking innate and acquired immunity [24]. TLR4 expressed on the surface of a variety of cells is one of the best studied TLR subtypes. Recently, TLR4 was reported to express in renal tubular epithelial cells in diabetic rats. TLR4 activation induces production of cytokines and chemokines and participates in various immune and inflammatory reactions [25, 26]. TLR4 activates the NF-κB signaling pathway, resulting in inflammatory factor released. After NF-κB activation, IL-1β, TGF-β1 and TNF-α transcriptions and translations are initiated, which then activates the Smad signaling pathway. NF-κB also stimulates the transcription of several fiber-related factors, such as ICAM-1 and VCAM-1 [27], and promotes the proliferation and differentiation of renal tubular cells.

Triptolide has strong anti-inflammatory effects. In line with our study, Triptolide inhibits the expression of various cytokines and adhesion molecules, which inhibits the activation of inflammatory cells, such as neutrophils and macrophages, thereby inhibiting inflammation [28, 29]. In this study, Triptolide reduces renal tubular epithelial cell vacuolization and granular degeneration, as well as inflammatory cell infiltration, and improves renal tubular expansion and contraction via downregulation of the expression of TLR4, NF-κB, TGF-β1 and ICAM-1 in vivo and in vitro. This might be one of the mechanisms underlying the effects of triptolide on renal tubular interstitial injury.

miRNAs play an important role in cell proliferation, growth, differentiation and apoptosis [30, 31]. Several important miRNAs were found to highly express in renal tissue. Using miRNA gene chip technology, high expression levels of mir-192, miR-194, miRNA-204, miRNA-215, miRNA-217, miRNA-27a, mirna-27b and miRNA-29c have been noted in kidney tissues [32-34]. Abnormal miRNA expression may lead to the development of renal disease. In this study, we analyzed the levels of miRNA expression using miRNA microarray technology. Our results showed that miR-224-3p expression was significantly downregulated in the high-glucose group, while triptolide reversed the inhibition of miR-224-3p. After the cells were transfected with miR-224-3p mimics, the expressions of TLR4, NF-κB, TGF-β1, ICAM-1 and other inflammatory factors were decreased significantly, indicating that miR-224-3p mediated the decrease in inflammation in DN by triptolide.

In conclusion, miR-224-3p expression was decreased in DN. Triptolide upregulated miR-224-3p expression, which resulted in decreased TLR4, NF-κB, TGF-β1 and ICAM-1 expressions and reduced inflammation. This may represent the novel mechanism by which triptolide improves DN.

The plasma level of miR-224-3p was significantly decreased in DN patients.

Figure 8: The plasma level of miR-224-3p was significantly decreased in DN patients.

MATERIALS AND METHODS

Animals

SD male rats were purchased from HFK Bioscience Company (Beijing, China). All experimental rats were maintained under specific pathogen-free conditions in the animal facility of Tianjin Medical University (China) and used for experimentation at 6 wk. The Tianjin Medical University Experimental Animal Ethics Committee approved all animal procedures.

Rats were randomly assigned to 3 groups. The rats were fed a standard diet (8% fat) or a high-fat diet (HFD) containing 40% fat for 8 weeks. The HFD animals were intraperitoneally injected with a single dose of STZ (30 mg/kg) in 50 mM citrate buffer (pH 4.0), while the control animals received an equal volume of citrate buffer. The hyperglycemia noted in the HFD rats after STZ injection was not due to declining beta-cell function [35]. Animals with blood glucose levels ≥ 16.7 mmol/L were deemed diabetes. 24h UMA levels ≥30 mg were considered to have DN.

The animals were divided into the following 3 groups: NC, DN and DN + Triptolide ( triptolide 200 μg/kg∙d via gavage for 12 weeks).

Cell culture and treatment

Rat kidney tubular epithelial cells (NRK52E cells; American Type Culture Collection,

Rockville, MD, USA) were maintained in DMEM containing 10% FBS, penicillin (200 U/mL), and streptomycin (200 μg/mL) (Gibco BRL, Grand Island, NY, USA) at 37 oC in a humidified incubator containing 5% CO2. The cells were divided into (1) the NG group incubated in DMEM containing 5.56 mmol/L glucose, (2) the MA group incubated in DMEM containing 5.56 mmol/L glucose and 54.44 mmol/L mannitol, (3) the HG group incubated in DMEM containing 25 mM glucose, and (4) the HG+TP group incubated with 5 ng/mL triptolide in DMEM containing 25 mM glucose for 24h.

Gene chip technology analysis

Total RNA was isolated using TRIzol (Invitrogen, USA) and purified with an RNeasy mini kit (QIAGEN, GER), according to manufacturer’s instructions. Shanghai Biotechnology Co., Ltd conducted the MicroRNA microarray gene expression experiments and data analysis.

Transfection of the miRNA mimic and inhibitors

An miR224-3p mimic, miR224-3p inhibitor, and appropriate negative controls (NC) of the miRNA inhibitor (miR-iNC) and miRNA mimic (miR-NC) were purchased from GenePharma (Sunzhou, China) and transfected at final concentrations ranging from 50-100 nM using Lipofectamine 2000 transfection reagent (Invitrogen, USA), in accordance with the manufacturer’s recommendations. The transfected cells were growth-arrested via overnight incubation with serum-free medium prior to incubation with 25 mM glucose for 48h.

Luciferase reporter assay for miR224-3p binding the TLR4 3′-UTR

A luciferase reporter assay was conducted using a Dual-Luciferase Reporter Assay System (Promega, USA), according to the manufacturer’s instructions. 293T cells (1.5×104/well) were seeded into 96-well plates. After 12 h, the cells were transiently co-transfected with 0.1 μg/well pRL-TK plasmid (Promega) containing a Renilla luciferase gene for internal normalization and various constructs containing pMIR-TLR4 and pMIR-TLR4-mut. Cells were lysed and assayed for luciferase activity 36h after transfection. One hundred microliters of protein extracts were analyzed in a luminometer. All experiments were performed at least three times.

Histological analysis

Kidney tissues were fixed in formalin, embedded in paraffin, and cut into 5 μm thick sections. The sections were stained with a hematoxylin and eosin (HE) staining kit (Baibo Biotechnology Co., Ltd., Shandong, China), periodic acid-Schiff (PAS) staining kit and Masson’s trichrome (MT) staining kit (Nanjing Jiancheng Bioengineering Institute, Jiangsu, China) according to the manufacturer’s protocols. For each slide, 10 randomly selected non-overlapping fields of renal cortex without glomeruli and large vessels were measured, and the averages for each group were analyzed.

Immunohistochemistry staining of renal tissues

Formalin-fixed, paraffin-embedded sections (4μm thick) were deparaffinized by xylene and hydrated by graded ethanol. Heat-induced antigen retrieval was conducted at 95 oC by microwave in 10 mmol/L sodium citrate buffer (pH 6.0) for 5 min. Then, the sections were blocked with 5% BSA for 30 min and incubated overnight at 4°C with the following antibodies diluted with PBS: anti-NF-κB (Cell Signaling Technology, 1:100), anti-TGF-β1 (Abcam, 1:200), anti-ICAM-1 (Abcam, 1:100) and anti-VCAM-1 (Abcam, 1:100). After washed three times in PBS, the sections were incubated for 45 min with the appropriate secondary antibody. The sections were subsequently visualized with a Diaminobenzidine (DAB) kit and counterstained with hematoxylin.

RNA isolation and analysis with qPCR

Total RNA was isolated by using Trizol reagent (Invitrogen, Carlsbad, CA, USA). This total RNA (1 μg) was then used for cDNA synthesis with a Transcriptor First Stand cDNA Synthesis Kit (Roche, IN, USA). Real-time quantitative PCR (qPCR) was performed using a quantitative SYBR Green PCR kit (TaKaRa, Dalian, China). The SYBR Green fluorescence absorption values in each tube were detected at the end of each cycle. miRNA and RNA expression levels were normalized to those of a specific small nuclear RNA (RNU6) or housekeeping gene (GAPDH). All primers are listed in Table 2.

Table 2: Primers used for transcript quantification by qPCR

Genea

Primer sequences (5,-3, )b

Hs/Rs miR-224-3p Stemloop

GTCGTATCCAGTGCAGGGTCCGAGG

TATTCGCACTGGATACGACTGTAGT

Rs miR-224-3p F

GGTCCAAATGGTGCCCTAGTG

Hs miR-224-3p F

GGTCCAAAATGGTGCCCTAGTGAC

Universal primer R

CCAGTGCAGGGTCCGAGGT

Hs/Rs RNU6 F

CTCGCTTCGGCAGCACATATACT

Hs/Rs RNU6 R

 ACGCTTCACGAATTTGCGTGTC

Rs TLR4 F

CCGCTCTGGCATCATCTTCA

Rs TLR4 R

TCCCACTCGAGGTAGGTGTT

Rs NF-Κb F

TGTCAACATTAGCGAGGGT

Rs NF-Κb R

CCTCGTTTGCACTGTTATG

Rs TGF-β1 F

CCTCCACCACTATGCAGGTC

Rs TGF-β1 R

CAGCCGACTCATTGGGATCA

Rs ICAM-1 F

CGTGGCGTCCATTTACACCT

Rs ICAM-1 R

TTAGGGCCTCCTCCTGAGC

Rs GAPDH F

GCAAGTTCAACGGCACAG

Rs GAPDH R

GCCAGTAGACTCCACGACAT

a Hs,human ;Rs,rat

b F,forward primer; R,reverse primer

Western blot analysis

The primary antibodies and their dilutions used were as follows: NF-κB p65 (1:1000), TGF-β1 (1:2000), ICAM-1 (1:2000), VCAM-1 (1:1000) and β-actin (Sigma-Aldrich, 1:1000). Following incubation with horseradish peroxidase-coupled secondary anti-mouse/rabbit (Tianjin Sungene Biotech), protein bands were visualized using ECL Blotting Detection Reagents (NCI4106, Thermo Pierce ECL). The blots were quantified via densitometry using Image J software.

Patients and specimens

The participants were recruited in our hospital from January to July 2015 in Tianjin, China (Table 3). DN was diagnosed based on a urinary albumin excretion ratio greater than or equal to 30 mg/24 h, a serum creatinine greater than 167 μmol/L or a blood urea nitrogen greater than 7.8 mmol/L. Individuals were excluded if they were pregnant or lactating, had type 1 diabetes or another type of diabetes, had another secondary renal disease or renal dysfunction caused by primary renal disease or hypertension, had active liver disease or abnormal liver function, had a urinary tract infection or had severe hypertension. Serum and urine samples were collected from 12 patients. The control group is comprised of 12 healthy subjects.

Table 3: Characteristics of the Study Population

Variables

NC

DM

DN

Patient number(n)

12

12

12

Gender(F/M)

6/6

7/5

6/6

Age(year)

52.4±10.3

51.7±12.1

57.3±12.7

Course of disease(year)

 

6.7±3.5

13.8±4.7

BMI(Kg/m2)

25.9±1.8

26.2±2.3

26.9±2.4

High pressure(mmHg)

130±10

134±12

138±21

Low pressure(mmHg)

81±11

83±16

85±18

HbA1c(%)

5.2±0.8

9.6±1.4*

10.1±2.7*

Blood Glucose(mmol/L)

4.9±1.1

9.9±2.1*

10.7±1.7*

24h-UTP(g/24h)

 

0.1±0.008

1.98±0.96#

Scr(mmol/L)

47±6.7

58.8±8.1

67.5±18.3

TG(mmol/L)

1.64±0.41

2.39±1.73

1.97±0.65

LDL(mmol/L)

2.87±0.34

3.22±0.59

3.63±0.59

NC=non-Diabetes,DM=Diabetes,DN=Diabetic nephropathy.

*Indicated control with NC,P<0.05

# Indicated control with DM,P<0.01

Statistical analysis

All data are expressed as the mean ± standard error (SE). Comparisons between two parameters were analyzed by Student’s unpaired t-test. P < 0.05 was considered statistically significant. Between-group differences in latency were analyzed via analysis of variance for repeated measurements (ANOVAR), followed by Fisher’s post hoc test for all groups.

ACKNOWLEDGMENTS

We thank the staff of the animal facility of Tianjin Medical University.

CONFLICTS OF INTEREST

The authors declare no competing financial interests.

GRANT SUPPORT

This work was supported by the grants from the National Natural Science Foundation of China (No. 81470187, 81273915, 81072922 to Chen L.M.).

References

1. Gross J L, De Azevedo M J, Silveiro S P, Canani L H, Caramori M L, Zelmanovitz T. Diabetic nephropathy: diagnosis, prevention, and treatment. Diabetes Care.2005;28:164-76.

2. Reutens A T, Atkins R C. Epidemiology of diabetic nephropathy. Contrib Nephrol.2011;170:1-7.

3. Park C W. Diabetic kidney disease: from epidemiology to clinical perspectives. Diabetes Metab J.2014;38:252-60.

4. Luis-Rodriguez D, Martinez-Castelao A, Gorriz J L, De-Alvaro F, Navarro-Gonzalez J F. Pathophysiological role and therapeutic implications of inflammation in diabetic nephropathy. World J Diabetes.2012;3:7-18.

5. Mudaliar H, Pollock C, Komala M G, Chadban S, Wu H, Panchapakesan U. The role of Toll-like receptor proteins (TLR) 2 and 4 in mediating inflammation in proximal tubules. Am J Physiol Renal Physiol.2013;305:F143-54.

6. Mezzano S, Aros C, Droguett A, Burgos M E, Ardiles L, Flores C, Schneider H, Ruiz-Ortega M, Egido J. NF-kappaB activation and overexpression of regulated genes in human diabetic nephropathy. Nephrol Dial Transplant.2004;19:2505-12.

7. Lin M, Yiu W H, Wu H J, Chan L Y, Leung J C, Au W S, Chan K W, Lai K N, Tang S C. Toll-like receptor 4 promotes tubular inflammation in diabetic nephropathy. J Am Soc Nephrol.2012;23:86-102.

8. Fried L F, Emanuele N, Zhang J H, Brophy M, Conner T A, Duckworth W, Leehey D J, Mccullough P A, O’Connor T, Palevsky P M, Reilly R F, Seliger S L, Warren S R, et al. Combined angiotensin inhibition for the treatment of diabetic nephropathy. N Engl J Med.2013;369:1892-903.

9. Packham D K, Wolfe R, Reutens A T, Berl T, Heerspink H L, Rohde R, Ivory S, Lewis J, Raz I, Wiegmann T B, Chan J C, De Zeeuw D, Lewis E J, et al. Sulodexide fails to demonstrate renoprotection in overt type 2 diabetic nephropathy. J Am Soc Nephrol.2012;23:123-30.

10. Ismail-Beigi F, Craven T, Banerji M A, Basile J, Calles J, Cohen R M, Cuddihy R, Cushman W C, Genuth S, Jr Grimm R H, Hamilton B P, Hoogwerf B, Karl D, et al. Effect of intensive treatment of hyperglycaemia on microvascular outcomes in type 2 diabetes: an analysis of the ACCORD randomised trial. Lancet.2010;376:419-30.

11. Ma J, Xu L, Dong J, Wei H, Zhi Y, Ma X, Zhang W. Effects of zishentongluo in patients with early-stage diabetic nephropathy. Am J Chin Med.2013;41:333-40.

12. Kitada M, Kume S, Imaizumi N, Koya D. Resveratrol improves oxidative stress and protects against diabetic nephropathy through normalization of Mn-SOD dysfunction in AMPK/SIRT1-independent pathway. Diabetes.2011;60:634-43.

13. Ma R, Liu L, Liu X, Wang Y, Jiang W, Xu L. Triptolide markedly attenuates albuminuria and podocyte injury in an animal model of diabetic nephropathy. Exp Ther Med.2013;6:649-56.

14. Gao Q, Shen W, Qin W, Zheng C, Zhang M, Zeng C, Wang S, Wang J, Zhu X, Liu Z. Treatment of db/db diabetic mice with triptolide: a novel therapy for diabetic nephropathy. Nephrol Dial Transplant.2010;25:3539-47.

15. Wen H L, Liang Z S, Zhang R, Yang K. Anti-inflammatory effects of triptolide improve left ventricular function in a rat model of diabetic cardiomyopathy. Cardiovasc Diabetol.2013;12:50.

16. Ma Z J, Zhang X N, Li L, Yang W, Wang S S, Guo X, Sun P, Chen L M. Tripterygium Glycosides Tablet Ameliorates Renal Tubulointerstitial Fibrosis via the Toll-Like Receptor 4/Nuclear Factor Kappa B Signaling Pathway in High-Fat Diet Fed and Streptozotocin-Induced Diabetic Rats. J Diabetes Res.2015;2015:390428.

17. Huntzinger E, Izaurralde E. Gene silencing by microRNAs: contributions of translational repression and mRNA decay. Nat Rev Genet.2011;12:99-110.

18. Krupa A, Jenkins R, Luo D D, Lewis A, Phillips A, Fraser D. Loss of MicroRNA-192 promotes fibrogenesis in diabetic nephropathy. J Am Soc Nephrol.2010;21:438-47.

19. Wang Q, Wang Y, Minto A W, Wang J, Shi Q, Li X, Quigg R J. MicroRNA-377 is up-regulated and can lead to increased fibronectin production in diabetic nephropathy. FASEB J.2008;22:4126-35.

20. Putta S, Lanting L, Sun G, Lawson G, Kato M, Natarajan R. Inhibiting microRNA-192 ameliorates renal fibrosis in diabetic nephropathy. J Am Soc Nephrol.2012;23:458-69.

21. Tang S C, Leung J C, Lai K N. Diabetic tubulopathy: an emerging entity. Contrib Nephrol.2011;170:124-34.

22. Duran-Salgado M B, Rubio-Guerra A F. Diabetic nephropathy and inflammation. World J Diabetes.2014;5:393-98.

23. Navarro-Gonzalez J F, Mora-Fernandez C. The role of inflammatory cytokines in diabetic nephropathy. J Am Soc Nephrol.2008;19:433-42.

24. Jialal I, Kaur H. The Role of Toll-Like Receptors in Diabetes-Induced Inflammation: Implications for Vascular Complications. Curr Diab Rep.2012.

25. Lin M, Yiu W H, Li R X, Wu H J, Wong D W, Chan L Y, Leung J C, Lai K N, Tang S C. The TLR4 antagonist CRX-526 protects against advanced diabetic nephropathy. Kidney Int.2013;83:887-900.

26. Kaur H, Chien A, Jialal I. Hyperglycemia induces Toll like receptor 4 expression and activity in mouse mesangial cells: relevance to diabetic nephropathy. Am J Physiol Renal Physiol.2012;303:F1145-50.

27. Kuhad A, Chopra K. Attenuation of diabetic nephropathy by tocotrienol: involvement of NFkB signaling pathway. Life Sci.2009;84:296-301.

28. Zhang N, Xu Y J, Zhang Z X. [Regulatory function of nuclear factor kappa B on lymphocyte proliferation and apoptosis in bronchial asthmatic rats and effect of triptolide on the regulation]. Zhongguo Zhong Xi Yi Jie He Za Zhi.2004;24:435-38.

29. Liu Q, Chen T, Chen G, Li N, Wang J, Ma P, Cao X. Immunosuppressant triptolide inhibits dendritic cell-mediated chemoattraction of neutrophils and T cells through inhibiting Stat3 phosphorylation and NF-kappaB activation. Biochem Biophys Res Commun.2006;345:1122-30.

30. Bartel D P. MicroRNAs: target recognition and regulatory functions. Cell.2009;136:215-33.

31. Sayed D, Abdellatif M. MicroRNAs in development and disease. Physiol Rev.2011;91:827-87.

32. Li J Y, Yong T Y, Michael M Z, Gleadle J M. Review: The role of microRNAs in kidney disease. Nephrology (Carlton).2010;15:599-608.

33. Lu X, Fan Q, Xu L, Li L, Yue Y, Xu Y, Su Y, Zhang D, Wang L. Ursolic acid attenuates diabetic mesangial cell injury through the up-regulation of autophagy via miRNA-21/PTEN/Akt/mTOR suppression. PLoS One.2015;10:e117400.

34. Zhang Z, Luo X, Ding S, Chen J, Chen T, Chen X, Zha H, Yao L, He X, Peng H. MicroRNA-451 regulates p38 MAPK signaling by targeting of Ywhaz and suppresses the mesangial hypertrophy in early diabetic nephropathy. FEBS Lett.2012;586:20-26.

35. Kong L L, Wu H, Cui W P, Zhou W H, Luo P, Sun J, Yuan H, Miao L N. Advances in murine models of diabetic nephropathy. J Diabetes Res.2013;2013:797548.


Creative Commons License All site content, except where otherwise noted, is licensed under a Creative Commons Attribution 4.0 License.
PII: 13127